tcf7l2

Ensembl ID:
ENSDARG00000004415
ZFIN ID:
ZDB-GENE-991110-8
Description:
transcription factor 7-like 2 [Source:RefSeq peptide;Acc:NP_571334]
Human Orthologue:
TCF7L2
Human Description:
transcription factor 7-like 2 (T-cell specific, HMG-box) [Source:HGNC Symbol;Acc:11641]
Mouse Orthologue:
Tcf7l2
Mouse Description:
transcription factor 7-like 2, T-cell specific, HMG-box Gene [Source:MGI Symbol;Acc:MGI:1202879]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3824 Essential Splice Site Mutation detected in F1 DNA During 2014
sa103 Nonsense Available for shipment Available now
sa22132 Nonsense Mutation detected in F1 DNA During 2014
sa2624 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa3824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005562 Essential Splice Site 316 477 9 15
ENSDART00000009237 Essential Splice Site 277 438 8 14
ENSDART00000031408 Essential Splice Site 316 610 9 14
ENSDART00000121527 Essential Splice Site 316 597 9 15
ENSDART00000122972 None None 235 None 6
ENSDART00000123318 Essential Splice Site 277 426 8 13
ENSDART00000125046 None None 268 None 7
ENSDART00000128703 None None 181 None 5
ENSDART00000133854 None None 118 None 4

The following transcripts of ENSDARG00000004415 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 32676860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGMACCAAAAGATGTTATGCAAACATTAAAATCRCCTCCTTCTCATTTGC[A/T]GGAAACATCAGGATGCGAAAAAGGAGGAGGAAAAGAAGAAGCAGCCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa103
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005562 Nonsense 376 477 10 15
ENSDART00000009237 Nonsense 337 438 9 14
ENSDART00000031408 Nonsense 376 610 10 14
ENSDART00000121527 Nonsense 376 597 10 15
ENSDART00000122972 None None 235 None 6
ENSDART00000123318 Nonsense 337 426 9 13
ENSDART00000125046 None None 268 None 7
ENSDART00000128703 None None 181 None 5
ENSDART00000133854 None None 118 None 4

The following transcripts of ENSDARG00000004415 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 32676376)
KASP Assay ID:
554-0075.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGATGGATGTCTGTGTGTTTCTCTGTGTACAGTGGCACGCTCTGTCA[C/T]GAGAGGAGCAGGCCAAATACTACGAATTAGCCAGGAAAGAACGACAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22132
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005562 Nonsense 400 477 10 15
ENSDART00000009237 Nonsense 361 438 9 14
ENSDART00000031408 Nonsense 400 610 10 14
ENSDART00000121527 Nonsense 400 597 10 15
ENSDART00000122972 None None 235 None 6
ENSDART00000123318 Nonsense 361 426 9 13
ENSDART00000125046 None None 268 None 7
ENSDART00000128703 None None 181 None 5
ENSDART00000133854 None None 118 None 4

The following transcripts of ENSDARG00000004415 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 32676302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTAGCCAGGAAAGAACGACAGCTTCACATGCAGCTGTACCCCGGCTG[G/A]TCGGCACGAGACAACTATGTAAGTTTTTAAGTTTTCAACATGTAACAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2624
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005562 Essential Splice Site 422 477 11 15
ENSDART00000009237 Essential Splice Site 383 438 10 14
ENSDART00000031408 Essential Splice Site 422 610 11 14
ENSDART00000121527 Essential Splice Site 422 597 11 15
ENSDART00000122972 None None 235 None 6
ENSDART00000123318 Essential Splice Site 383 426 10 13
ENSDART00000125046 None None 268 None 7
ENSDART00000128703 None None 181 None 5
ENSDART00000133854 None None 118 None 4

The following transcripts of ENSDARG00000004415 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 32675341)
KASP Assay ID:
554-2443.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGAAAAAGAAGAAGAGAAAAAGGGAAAAGCAGGCAGGAGAGGGCAATG[G/A]TAAGTGTGCTGCAATTATCTCTCATATTAAAGCAGACCCATCATCTGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
  • Fasting insulin-related traits: New genetic loci implicated in fasting glucose homeostasis and their impact on type 2 diabetes risk. (View Study)
  • Fasting insulin-related traits (interaction with BMI): A genome-wide approach accounting for body mass index identifies genetic variants influencing fasting glycemic traits and insulin resistance. (View Study)
  • Glycated hemoglobin levels: The TCF7L2 diabetes risk variant is associated with HbA₁(C) levels: a genome-wide association meta-analysis. (View Study)
  • Metabolic syndrome: A genome-wide association study of the metabolic syndrome in Indian Asian men. (View Study)
  • Proinsulin levels: Genome-wide association identifies nine common variants associated with fasting proinsulin levels and provides new insights into the pathophysiology of type 2 diabetes. (View Study)
  • Two-hour glucose challenge: Genetic variation in GIPR influences the glucose and insulin responses to an oral glucose challenge. (View Study)
  • Type 2 diabetes: A genome-wide association study identifies novel risk loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: A genome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. (View Study)
  • Type 2 diabetes: A variant in CDKAL1 influences insulin response and risk of type 2 diabetes. (View Study)
  • Type 2 diabetes: Adiposity-related heterogeneity in patterns of type 2 diabetes susceptibility observed in genome-wide association data. (View Study)
  • Type 2 diabetes: Confirmation of multiple risk Loci and genetic impacts by a genome-wide association study of type 2 diabetes in the Japanese population. (View Study)
  • Type 2 diabetes: Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. (View Study)
  • Type 2 diabetes: Genome-wide association study for type 2 diabetes in Indians identifies a new susceptibility locus at 2q21. (View Study)
  • Type 2 diabetes: Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. (View Study)
  • Type 2 diabetes: Stratifying type 2 diabetes cases by BMI identifies genetic risk variants in LAMA1 and enrichment for risk variants in lean compared to obese cases. (View Study)
  • Type 2 diabetes: Twelve type 2 diabetes susceptibility loci identified through large-scale association analysis. (View Study)
  • Type 2 diabetes: Type 2 diabetes whole-genome association study in four populations: the DiaGen consortium. (View Study)
  • Type 2 diabetes: Use of diverse electronic medical record systems to identify genetic risk for type 2 diabetes within a genome-wide association study. (View Study)
  • Type 2 diabetes and other traits: Genetic variant near IRS1 is associated with type 2 diabetes, insulin resistance and hyperinsulinemia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sre3umrb