elovl6

Ensembl ID:
ENSDARG00000004402
ZFIN ID:
ZDB-GENE-030114-1
Description:
Elongation of very long chain fatty acids protein 6 [Source:UniProtKB/Swiss-Prot;Acc:Q6PC64]
Human Orthologue:
ELOVL6
Human Description:
ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) [Sour
Mouse Orthologue:
Elovl6
Mouse Description:
ELOVL family member 6, elongation of long chain fatty acids (yeast) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35729 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105602 Nonsense 2 266 1 4

The following transcripts of ENSDARG00000004402 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 37467219)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 35906546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGCTCACGTTCTTCAGTAAGCGTTCAGAGGACCACCAGAGACCATGT[C/A]GGTGCTGGCATTGCAAGAATACGAATTCGAGAGGCAGTTCAATGAAGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link