hdr

Ensembl ID:
ENSDARG00000004392
ZFIN ID:
ZDB-GENE-030826-5
Description:
hematopoietic death receptor [Source:RefSeq peptide;Acc:NP_919372]
Human Orthologues:
TNFRSF10A, TNFRSF10B, TNFRSF10C, TNFRSF10D
Human Descriptions:
tumor necrosis factor receptor superfamily, member 10a [Source:HGNC Symbol;Acc:11904]
tumor necrosis factor receptor superfamily, member 10b [Source:HGNC Symbol;Acc:11905]
tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain [Sourc
tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain [Source:HG
Mouse Orthologue:
Tnfrsf10b
Mouse Description:
tumor necrosis factor receptor superfamily, member 10b Gene [Source:MGI Symbol;Acc:MGI:1341090]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38475 Nonsense Mutation detected in F1 DNA During 2017
sa6979 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005025 Nonsense 47 418 2 10
ENSDART00000121886 Nonsense 47 357 2 10
ENSDART00000134894   None 340 None 8
Genomic Location (Zv9):
Chromosome 5 (position 29051638)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26806936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGAACAGATTAAGCCGAGATGTTTCATGCAGGGAAGGCTTGGAATA[T/A]CCACATGAAAACATCTGCTGTCTAAACTGCCCTGCTGGTGCGATTTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005025 Essential Splice Site 103 418 None 10
ENSDART00000121886 Essential Splice Site 103 357 None 10
ENSDART00000134894 Essential Splice Site 25 340 None 8
Genomic Location (Zv9):
Chromosome 5 (position 29051886)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26807184
KASP Assay ID:
554-4724.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGACCATGGATTGTTRAAGTGCATATCTTGCGACAAGTGCCGTATAGG[T/A]AAWTCKGCTGTTCATTTACAAATTTYCACTCTTCCAAGCTTTTCAGATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link