si:dkey-153k10.9

Ensembl ID:
ENSDARG00000004386
ZFIN ID:
ZDB-GENE-030131-3893
Description:
hypothetical protein LOC566596 [Source:RefSeq peptide;Acc:NP_001038575]
Human Orthologue:
KIAA1324L
Human Description:
KIAA1324-like [Source:HGNC Symbol;Acc:21945]
Mouse Orthologue:
9330182L06Rik
Mouse Description:
RIKEN cDNA 9330182L06 gene Gene [Source:MGI Symbol;Acc:MGI:2443264]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20210 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004604 Nonsense 987 1001 22 22
Genomic Location (Zv9):
Chromosome 4 (position 8751887)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9688735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTATTTACCTTTGTTTGTCTGCAGGCAGATGGAGATAACAGTGAGT[C/A]AGTGCAGCTGAAGTCATCTCAGTCAGAGCGGTGGGTTTGGGGATAACAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link