yrk

Ensembl ID:
ENSDARG00000004378
ZFIN ID:
ZDB-GENE-030131-9517
Description:
Yes-related kinase [Source:RefSeq peptide;Acc:NP_997946]
Human Orthologue:
FYN
Human Description:
FYN oncogene related to SRC, FGR, YES [Source:HGNC Symbol;Acc:4037]
Mouse Orthologue:
Fyn
Mouse Description:
Fyn proto-oncogene Gene [Source:MGI Symbol;Acc:MGI:95602]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10663 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102394 Nonsense 407 525 9 11
ENSDART00000102395 Nonsense 410 528 9 11
ENSDART00000136695 Nonsense 407 525 11 13
ENSDART00000147290 None None 27 None 2
ENSDART00000148287 Nonsense 410 528 11 13

The following transcripts of ENSDARG00000004378 do not overlap with this mutation:

Genomic Location:
Chromosome 19 (position 45159390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCTGTAAGATTGCAGATTTCGGTCTGGCTAGACTGATCGAGGACAAC[G/T]AGTACACAGCTAGACAAGGTCAATCCATGCTCCAAACTTGATCCTAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wtdok7ci