si:ch73-9j13.1

Ensembl ID:
ENSDARG00000004377
ZFIN ID:
ZDB-GENE-030131-9805
Description:
LOC563577 protein [Source:UniProtKB/TrEMBL;Acc:Q5D017]
Human Orthologue:
PPP1R13B
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 13B [Source:HGNC Symbol;Acc:14950]
Mouse Orthologue:
Ppp1r13b
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 13B Gene [Source:MGI Symbol;Acc:MGI:1336199]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18096 Nonsense Available for shipment Available now
sa36354 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23020 Nonsense Available for shipment Available now
sa15553 Nonsense Available for shipment Available now
sa17119 Nonsense Available for shipment Available now
sa42888 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037371 Nonsense 63 1110 2 18

The following transcripts of ENSDARG00000004377 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14505639)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14656467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATAATCAACAGTTGCTGACCGAGGTGCCCATTACYCCAGAGACGCTCTG[T/A]AARGATGTGGTGGARTTCTGTAAGGAGGCCGGAGAGAGCGGCTGCCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037371 Essential Splice Site 87 1110 2 18

The following transcripts of ENSDARG00000004377 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14505565)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14656393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGCCGGAGAGAGCGGCTGCCACCTCGCTGAAGTCTGGAAAGGAAAAG[G/T]TACCCATCTACCACCCTACAGTGCCTATAGAAAGTAATATTTGAAATAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037371 Nonsense 187 1110 6 18

The following transcripts of ENSDARG00000004377 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14468676)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14619504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCTCTCCTGTCCTCTCCTCCCATTTCCGCTCCGTCTTTTAGGAGCAA[C/T]GATTGCGGTATCTCAAGCAGCAGGACCCATGTCAGGGCCAGTCTGCGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037371 Nonsense 638 1110 13 18

The following transcripts of ENSDARG00000004377 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14459973)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14610801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCCTYATTTTAAACTTTATTTATTTTAATTTTCTTACAGTATATGGA[A/T]AACCAGTCCTACCAGGCTCCACCTCTCCRTCTCCAGTTCCACTCTACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037371 Nonsense 743 1110 13 18

The following transcripts of ENSDARG00000004377 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14459658)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14610486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAACCAGAAGGCCCCAGTGGGCCTAACATCCAGAAGCTCCTGTACCAA[C/T]GATTCAACACCCTTGCAGGGGGTATTGAGAGTGGAGTRGGTGGTACACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037371 Nonsense 754 1110 13 18

The following transcripts of ENSDARG00000004377 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 14459625)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14610453
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCTCCTGTACCAACGATTCAACACCCTTGCAGGGGGTATTGAGAGT[G/T]GAGTAGGTGGTACACCCTTCTACCAGCCTGACAGTCCTCTGAACTACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link