si:ch73-60e21.1

Ensembl ID:
ENSDARG00000004372
ZFIN ID:
ZDB-GENE-030131-1571
Description:
Wu:fb74h11 protein [Source:UniProtKB/TrEMBL;Acc:Q6NXC0]
Human Orthologue:
FMNL3
Human Description:
formin-like 3 [Source:HGNC Symbol;Acc:23698]
Mouse Orthologue:
Fmnl3
Mouse Description:
formin-like 3 Gene [Source:MGI Symbol;Acc:MGI:109569]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37715 Nonsense Mutation detected in F1 DNA During 2017
sa10571 Nonsense Available for shipment Available now
sa24340 Nonsense Available for shipment Available now
sa43989 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023359   None 390 None 11
ENSDART00000109023 Nonsense 567 992 18 27
ENSDART00000144554 Nonsense 60 485 3 13
ENSDART00000147440   None 468 None 14
Genomic Location (Zv9):
Chromosome 23 (position 25717770)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25503890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCCACTCAGATTATGTGCTTTTGTTTTGACATACAGGAATTGGATT[T/A]AGAAAAGTTTGAGGAGCTGTTCAAGACGAAAGCTCAGGGTCCCGTGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023359 Nonsense 5 390 1 11
ENSDART00000109023 Nonsense 607 992 18 27
ENSDART00000144554 Nonsense 100 485 3 13
ENSDART00000147440   None 468 None 14
Genomic Location (Zv9):
Chromosome 23 (position 25717889)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25504009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGGTCTCCCAGAAGGTCATCAACAAAGTTCAGCTGCTAGATGCCAAT[C/T]GATCAAAGAACTTGGCCATCACTTTACGCAAGGCMAACAAGACCACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023359 Nonsense 9 390 1 11
ENSDART00000109023 Nonsense 611 992 18 27
ENSDART00000144554 Nonsense 104 485 3 13
ENSDART00000147440   None 468 None 14
Genomic Location (Zv9):
Chromosome 23 (position 25717902)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25504022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGGTCATCAACAAAGTTCAGCTGCTAGATGCCAATCGATCAAAGAACT[T/A]GGCCATCACTTTACGCAAGGCCAACAAGACCACAGAGGAGATTTGCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023359 Nonsense 189 390 5 11
ENSDART00000109023 Nonsense 791 992 22 27
ENSDART00000144554 Nonsense 284 485 7 13
ENSDART00000147440   None 468 None 14
Genomic Location (Zv9):
Chromosome 23 (position 25719212)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25505332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACATTGCTCTGGTCGTCAAAGAGAAATATCCTGAACTGGCTAACTTCTA[C/A]AATGAACTGCACTTTGTGGATAAGGCCGCAGCAGGTTGGTGTTATTTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link