gnb3a

Ensembl ID:
ENSDARG00000004358
ZFIN ID:
ZDB-GENE-040718-134
Description:
guanine nucleotide binding protein (G protein), beta polypeptide 3a [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
GNB3
Human Description:
guanine nucleotide binding protein (G protein), beta polypeptide 3 [Source:HGNC Symbol;Acc:4400]
Mouse Orthologue:
Gnb3
Mouse Description:
guanine nucleotide binding protein (G protein), beta 3 Gene [Source:MGI Symbol;Acc:MGI:95785]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12105 Essential Splice Site Available for shipment Available now
sa9308 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12105
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012673 Essential Splice Site 234 340 8 9
ENSDART00000012673 Essential Splice Site 234 340 8 9
Genomic Location:
Chromosome 16 (position 13794771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTSAGCATGCCAGTAAATATATWTTTTTYTCTCTCTGTGTTGCCTTTC[A/G]GTTTTTCCCCAACGGCAATGCAGTGATCACAGGTTCAGACGATGCTTYCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012673 Essential Splice Site 234 340 8 9
ENSDART00000012673 Essential Splice Site 234 340 8 9
Genomic Location:
Chromosome 16 (position 13794771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTSAGCATGCCAGTAAATATATWTTTTTYTCTCTCTGTGTTGCCTTTC[A/G]GTTTTTCCCCAACGGCAATGCAGTGATCACAGGTTCAGACGATGCTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ej9y6vah