rdbp

Ensembl ID:
ENSDARG00000004343
ZFIN ID:
ZDB-GENE-040718-69
Description:
negative elongation factor E [Source:RefSeq peptide;Acc:NP_001002375]
Human Orthologue:
RDBP
Human Description:
RD RNA binding protein [Source:HGNC Symbol;Acc:13974]
Mouse Orthologue:
Rdbp
Mouse Description:
RD RNA-binding protein Gene [Source:MGI Symbol;Acc:MGI:102744]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13558 Essential Splice Site Available for shipment Available now
sa29220 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa13558
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113250 Essential Splice Site 57 378 2 11
Genomic Location:
Chromosome 19 (position 27409249)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGAYGAAGAAGCGCTGCAAAARAAGTATGCTAAACTGAAGAAAAAG[G/A]TAAAGACGATWGTTACTTTTCTCANNNNATATWTACAYGYACTTTCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113250 Nonsense 234 378 7 11
Genomic Location:
Chromosome 19 (position 27414028)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGGACCGGGAACGGGAACGAGACAGGAGCCGGGATGGAGAAAGAGAT[C/T]GAGAGAGGGACCGGGATCGAGACAGAGAACGAGACAGAGAGAGAGATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aj8g8kwf