exoc4

Ensembl ID:
ENSDARG00000004336
ZFIN ID:
ZDB-GENE-041210-112
Description:
exocyst complex component 4 [Source:RefSeq peptide;Acc:NP_001025305]
Human Orthologue:
EXOC4
Human Description:
exocyst complex component 4 [Source:HGNC Symbol;Acc:30389]
Mouse Orthologue:
Exoc4
Mouse Description:
exocyst complex component 4 Gene [Source:MGI Symbol;Acc:MGI:1096376]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa312 Nonsense F2 line generated During 2014
sa8527 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa312
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021384 Nonsense 92 968 3 18
ENSDART00000101619 Nonsense 92 487 3 10
Genomic Location:
Chromosome 4 (position 14678787)
KASP Assay ID:
554-3181.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGTGTGAACTTTCACCTTTTCCTCACGTGGGTTTCTCTGCTCAGGTC[A/T]AGGAGAACCTGCTGTCCTGTAAGATGCTCCTCCACTGTAAGCGGGATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021384 Essential Splice Site 777 968 15 18
ENSDART00000101619 None None 487 None 10
Genomic Location:
Chromosome 4 (position 14860593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAAGACAKCRCTGACCGCTGCCTGCTGGTGCTGCATCTGGAGGTTAG[G/A]TAGGTCTGACCACTTCATCTAAATCCRAGAAGAWGCCAGATGCATGTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p9c4q8ab