casp9

Ensembl ID:
ENSDARG00000004325
ZFIN ID:
ZDB-GENE-030825-5
Description:
caspase 9, apoptosis-related cysteine protease [Source:RefSeq peptide;Acc:NP_001007405]
Human Orthologue:
CASP9
Human Description:
caspase 9, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1511]
Mouse Orthologue:
Casp9
Mouse Description:
caspase 9 Gene [Source:MGI Symbol;Acc:MGI:1277950]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11164 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047020 Essential Splice Site 146 436 3 10

The following transcripts of ENSDARG00000004325 do not overlap with this mutation:

Genomic Location:
Chromosome 23 (position 25264722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACCACTGAGACCTGAAAGCCTGCCGGTGCACAAGACATATAGTCCACG[T/C]AAGTCACTAGCTTTATAAGTTTCTGTTTTAATTTAAACAGNNNNNNNNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qprm0l62