casp9

Ensembl ID:
ENSDARG00000004325
ZFIN ID:
ZDB-GENE-030825-5
Description:
caspase 9, apoptosis-related cysteine protease [Source:RefSeq peptide;Acc:NP_001007405]
Human Orthologue:
CASP9
Human Description:
caspase 9, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1511]
Mouse Orthologue:
Casp9
Mouse Description:
caspase 9 Gene [Source:MGI Symbol;Acc:MGI:1277950]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11164 Essential Splice Site Available for shipment Available now
sa37709 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37710 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047020 Essential Splice Site 146 436 3 10

The following transcripts of ENSDARG00000004325 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 25264722)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25050842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACCACTGAGACCTGAAAGCCTGCCGGTGCACAAGACATATAGTCCACG[T/C]AAGTCACTAGCTTTATAAGTTTCTGTTTTAATTTAAACAGNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37709
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047020 Essential Splice Site 163 436 5 10

The following transcripts of ENSDARG00000004325 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 25267092)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25053212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTCTTTTCGGCTTAGTCCCTTATTAATCTGGGGTTAATATTTTTTC[A/T]GTGCTACAAGATGGATGCCAGTCCGTGTGGGGTCTGCTTGATCATAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047020 Nonsense 366 436 9 10

The following transcripts of ENSDARG00000004325 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 25271855)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25057975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTGAGTTCATATTAAATGGTGTGCATGATGATTTATTTGCAGGTTA[T/A]GTCTCCTGGAGGGACACAGAGGCCGGCTCTTGGTATGTGGAGAATCTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link