LOC100330314

Ensembl ID:
ENSDARG00000004322
Human Orthologue:
USH1G
Human Description:
Usher syndrome 1G (autosomal recessive) [Source:HGNC Symbol;Acc:16356]
Mouse Orthologue:
Ush1g
Mouse Description:
Usher syndrome 1G homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2450757]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023265 Nonsense 60 471 2 3
Genomic Location:
Chromosome 3 (position 57598156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGACATGGACCTGTCATGGATCTATTACTTTCAGGGGGAACCCAGAT[A/T]AGTGTGACATATGGGGAAACACGCCACTTCACCTGGCTGCCTCCAATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rf9uhmo0