cbwd

Ensembl ID:
ENSDARG00000004318
ZFIN ID:
ZDB-GENE-040426-2388
Description:
COBW domain containing [Source:RefSeq peptide;Acc:NP_998418]
Human Orthologues:
CBWD1, CBWD2, CBWD3, CBWD5, CBWD6, CBWD7
Human Descriptions:
COBW domain containing 1 [Source:HGNC Symbol;Acc:17134]
COBW domain containing 2 [Source:HGNC Symbol;Acc:17907]
COBW domain containing 3 [Source:HGNC Symbol;Acc:18519]
COBW domain containing 5 [Source:HGNC Symbol;Acc:24584]
COBW domain containing 6 [Source:HGNC Symbol;Acc:31978]
COBW domain containing 7 [Source:HGNC Symbol;Acc:31977]
Mouse Orthologue:
Cbwd1
Mouse Description:
COBW domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385089]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27234 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012132 Essential Splice Site 237 366 11 16
Genomic Location (Zv9):
Chromosome 8 (position 31291091)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30433817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGAAGTATTAGACTTGCATTCTTTTGACACTAAAGATGGTGAAAGG[T/C]AAGCGTTTTCCTGCAAGAAAACTTCCAACAATTACACTCACTGAAGTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link