cbwd

Ensembl ID:
ENSDARG00000004318
ZFIN ID:
ZDB-GENE-040426-2388
Description:
COBW domain containing [Source:RefSeq peptide;Acc:NP_998418]
Human Orthologues:
CBWD1, CBWD2, CBWD3, CBWD5, CBWD6, CBWD7
Human Descriptions:
COBW domain containing 1 [Source:HGNC Symbol;Acc:17134]
COBW domain containing 2 [Source:HGNC Symbol;Acc:17907]
COBW domain containing 3 [Source:HGNC Symbol;Acc:18519]
COBW domain containing 5 [Source:HGNC Symbol;Acc:24584]
COBW domain containing 6 [Source:HGNC Symbol;Acc:31978]
COBW domain containing 7 [Source:HGNC Symbol;Acc:31977]
Mouse Orthologue:
Cbwd1
Mouse Description:
COBW domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385089]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44690 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27234 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012132 Essential Splice Site 63 366 3 16
Genomic Location (Zv9):
Chromosome 8 (position 31276420)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30419146
GRCz11 8 30428378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAACATAATAAGCGAATAGCTGTCATACTCAATGAATTTGGGGAAGG[T/C]AAGTTATAAGACAAACAACAAATAAACAATCAAAAAGGCCTCTAGCCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012132 Essential Splice Site 237 366 11 16
Genomic Location (Zv9):
Chromosome 8 (position 31291091)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30433817
GRCz11 8 30443049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGAAGTATTAGACTTGCATTCTTTTGACACTAAAGATGGTGAAAGG[T/C]AAGCGTTTTCCTGCAAGAAAACTTCCAACAATTACACTCACTGAAGTATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link