fam8a1

Ensembl ID:
ENSDARG00000004308
ZFIN ID:
ZDB-GENE-050410-14
Description:
family with sequence similarity 8, member A1 [Source:RefSeq peptide;Acc:NP_001017551]
Human Orthologue:
FAM8A1
Human Description:
family with sequence similarity 8, member A1 [Source:HGNC Symbol;Acc:16372]
Mouse Orthologue:
C78339
Mouse Description:
expressed sequence C78339 Gene [Source:MGI Symbol;Acc:MGI:2145496]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2878 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021533 Nonsense 256 345 4 5
ENSDART00000123237 Nonsense 259 348 4 5
Genomic Location:
Chromosome 16 (position 27833721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAAGAGCTGTGTAACTGTGTTCTGATTGTTTTCAGATCATATGTATTT[G/A]GGGAGCTGGAGGGGCCACACCAGGGAAGTTCCTCATTGGTTTGCGAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ytv9vfb2