ambpl

Ensembl ID:
ENSDARG00000004296
ZFIN ID:
ZDB-GENE-040426-1608
Description:
protein AMBP precursor [Source:RefSeq peptide;Acc:NP_957412]
Human Orthologue:
AMBP
Human Description:
alpha-1-microglobulin/bikunin precursor [Source:HGNC Symbol;Acc:453]
Mouse Orthologue:
Ambp
Mouse Description:
alpha 1 microglobulin/bikunin Gene [Source:MGI Symbol;Acc:MGI:88002]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21678 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21679 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21678
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027026 Essential Splice Site 83 346 None 10

The following transcripts of ENSDARG00000004296 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 10769164)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCAGCGGGTCACCACAAAGCCTCAGCATGACCCGCATCGGCCTCAGG[T/C]ACAAACACAAACATCAACAGCAAATTAATAATCAATCACAAACACACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21679
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027026 Essential Splice Site 181 346 5 10

The following transcripts of ENSDARG00000004296 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 10782838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGAACAAGGAATGAGTGAAGACACTATCATAATTAAAAAGAACAAAG[G/A]TATCCTCACAAAAACATTCATTCATTAATTCATTTTCTTTTTTAGCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/08iu5tvl