si:ch211-106n13.1

Ensembl ID:
ENSDARG00000004291
ZFIN ID:
ZDB-GENE-060503-2
Description:
E3 ubiquitin-protein ligase HECW1 [Source:RefSeq peptide;Acc:NP_001139236]
Human Orthologue:
HECW1
Human Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:22195]
Mouse Orthologue:
Hecw1
Mouse Description:
HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc:MGI:2444

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11509 Nonsense Available for shipment Available now
sa19894 Essential Splice Site Available for shipment Available now
sa33041 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9016 Nonsense Mutation detected in F1 DNA During 2017
sa33040 Nonsense Mutation detected in F1 DNA During 2017
sa33039 Nonsense Available for shipment Available now
sa33038 Nonsense Mutation detected in F1 DNA During 2017
sa33037 Nonsense Mutation detected in F1 DNA During 2017
sa14857 Essential Splice Site Available for shipment Available now
sa19893 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Nonsense 258 1538 5 28
ENSDART00000142835 Nonsense 272 1552 6 29
Genomic Location (Zv9):
Chromosome 2 (position 50513836)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50209368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCAGGAGAARAGATCCGGCATCKTCTGCAATACCATTAATCCTGTWT[G/A]GCAGAGGGAGGTATGGCAAACAAACAAGAGCAAACGCACCAGATTAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Essential Splice Site 309 1538 6 28
ENSDART00000142835 Essential Splice Site 323 1552 7 29
Genomic Location (Zv9):
Chromosome 2 (position 50506769)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50202301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAAGCTGTCCATGCCAGTGCAAAGACTACTGGAGAAGCATGCTATCGG[G/A]TACGCATTACCACCACACCACATGACAACAACCTCAAAACTTTATTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Essential Splice Site 343 1538 8 28
ENSDART00000142835 Essential Splice Site 357 1552 9 29
Genomic Location (Zv9):
Chromosome 2 (position 50501877)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50197409
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTATGCATCGTGCCAAATATGTGTAGGTCACAGATTTCTTCTCCCCAC[A/T]GATGATGAAGACATGTCTCTCAGCACAGAGCAGCCGGTGGCAGCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Nonsense 430 1538 8 28
ENSDART00000142835 Nonsense 444 1552 9 29
Genomic Location (Zv9):
Chromosome 2 (position 50501615)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50197147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAGAACAGCAGGAAGGAGAAGCAGCWGCAGCAGCAGCANNNATGGAG[C/T]AAAGTGAAACCAATGCAGAAGAAACAACACAAGTAAAAGAATTTAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Nonsense 729 1538 10 28
ENSDART00000142835 Nonsense 743 1552 11 29
Genomic Location (Zv9):
Chromosome 2 (position 50495787)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50191319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTATGAAGAATGTGCTGGCTTGTGTTTGTGGTGTGTTTAGGAGAATG[T/A]CCTTTGCCTTGTAACCACCCTGCAGTGAGTCAGCTGCCTGCCCTGCGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Nonsense 804 1538 11 28
ENSDART00000142835 Nonsense 818 1552 12 29
Genomic Location (Zv9):
Chromosome 2 (position 50492082)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50187614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACATCTGCAGCCACGCCGGACGGCCTACGCAGGTCTGGATCCGTCCAA[C/T]AGATGGAGCAGCTCAACAGGAGGTAAACAACACTGGGCATCAGCCATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Nonsense 927 1538 14 28
ENSDART00000142835 Nonsense 941 1552 15 29
Genomic Location (Zv9):
Chromosome 2 (position 50485064)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50180596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTTCACCAACAGCTCGTGTCTGAAACACATGGTCCTGAAAATTCGA[C/T]GAGATGCTCGAAATTTTGAGCGCTACCAGCACAATCGTGACCTGGTGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Nonsense 1192 1538 21 28
ENSDART00000142835 Nonsense 1206 1552 22 29
Genomic Location (Zv9):
Chromosome 2 (position 50473517)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50169049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTAATTTATTTTTTTTTTCAGATTGATCGTCAGAAGAGATCATCTTT[T/A]AGAAGGAACGTTTAACCAGGTCATGGCCTACTCACGTAAAGAGCTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412   1397 1538 25 28
ENSDART00000142835 Essential Splice Site 1411 1552 26 29
Genomic Location (Zv9):
Chromosome 2 (position 50461695)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50157227
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGAGGCGTTGTCCAGCAGACACAGGCTCTGGTGCGAGGATTTTATGAG[G/A]TAAACATGCTTAASATCCAATTTACTCTCTGCTGTGTACTATTAAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029412 Nonsense 1506 1538 28 28
ENSDART00000142835 Nonsense 1520 1552 29 29
Genomic Location (Zv9):
Chromosome 2 (position 50455033)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 50150565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTCTTGCTGATGTATGTCTCTCATGTTTCTCAGGGCGCACACATG[C/A]TTTAACCGTCTGGATCTTCCACCATATCCATCCTACACGATGTTATACGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link