accn4b

Ensembl ID:
ENSDARG00000004243
ZFIN ID:
ZDB-GENE-040513-6
Description:
Amiloride-sensitive cation channel 4-B [Source:UniProtKB/Swiss-Prot;Acc:Q708S3]
Human Orthologue:
ACCN4
Human Description:
amiloride-sensitive cation channel 4, pituitary [Source:HGNC Symbol;Acc:21263]
Mouse Orthologue:
Accn4
Mouse Description:
amiloride-sensitive cation channel 4, pituitary Gene [Source:MGI Symbol;Acc:MGI:2652846]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14893 Nonsense Available for shipment Available now
sa8225 Nonsense Mutation detected in F1 DNA During 2014
sa16524 Nonsense Available for shipment Available now
sa12799 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Nonsense 309 558 4 10
Genomic Location:
Chromosome 6 (position 13578561)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCRTGGGGAAACTGTCGGGCTTCATCCGAGCCTGTGATCCCAGGWTA[C/A]GACACCTACAGCGTCAGCGCCTGCAGACTGCACTGTGAGAGCACACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Nonsense 380 558 6 10
Genomic Location:
Chromosome 6 (position 13586313)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGTGACTCATGTCCCTGCGAGACACCCTGTAATTTGACCCGGTATGGG[A/T]AAGAGCTCTCTATGGTTAAAATCCCCAGCAGAGGCTCTGCTCGCTACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Nonsense 508 558 9 10
Genomic Location:
Chromosome 6 (position 13597570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCAGATCCAGAGAACCAAGAACCTGCGGGAGCAGAACCTRAAAGCT[C/T]AGCTAACTGCCGGAGCAATAGCTACAGTCARGTTTGAAGAAGTCAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Essential Splice Site 525 558 9 10
Genomic Location:
Chromosome 6 (position 13597624)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTGCCGGAGCAATAGCTACAGTCARGTTTGAAGAAGTCAAAGTCAAG[G/A]TGAGTCRGGGAAATAAAGTGTATTCCAAACAMAMACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/txwraxmv