accn4b

Ensembl ID:
ENSDARG00000004243
ZFIN ID:
ZDB-GENE-040513-6
Description:
Amiloride-sensitive cation channel 4-B [Source:UniProtKB/Swiss-Prot;Acc:Q708S3]
Human Orthologue:
ACCN4
Human Description:
amiloride-sensitive cation channel 4, pituitary [Source:HGNC Symbol;Acc:21263]
Mouse Orthologue:
Accn4
Mouse Description:
amiloride-sensitive cation channel 4, pituitary Gene [Source:MGI Symbol;Acc:MGI:2652846]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33831 Nonsense Mutation detected in F1 DNA During 2016
sa14893 Nonsense Available for shipment Available now
sa40654 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16524 Nonsense Available for shipment Available now
sa12799 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Nonsense 111 558 1 10
Genomic Location (Zv9):
Chromosome 6 (position 13516249)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13373528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTATCTGGAGCGTCCCCACCTCGCAGCTCTAAGGGAAGAAACCCGCCGA[G/T]AGCTCACCTTTCCGGCCATCACGCTCTGTAACGTCAACAGATTCCGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Nonsense 309 558 4 10
Genomic Location (Zv9):
Chromosome 6 (position 13578561)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13435840
GRCz10 6 13540075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCRTGGGGAAACTGTCGGGCTTCATCCGAGCCTGTGATCCCAGGWTA[C/A]GACACCTACAGCGTCAGCGCCTGCAGACTGCACTGTGAGAGCACACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Essential Splice Site 439 558 8 10
Genomic Location (Zv9):
Chromosome 6 (position 13596749)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13454028
GRCz10 6 13558263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCTTTAGTTGCCCATTTTGATGTCATCACAGTGTGGTTTCTATTTTC[A/G]GGAGACATTGGTGGACAGATGGGCCTCTTCATTGGAGCCAGTATTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Nonsense 508 558 9 10
Genomic Location (Zv9):
Chromosome 6 (position 13597570)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13454849
GRCz10 6 13559084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCAGATCCAGAGAACCAAGAACCTGCGGGAGCAGAACCTRAAAGCT[C/T]AGCTAACTGCCGGAGCAATAGCTACAGTCARGTTTGAAGAAGTCAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12799
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104716 Essential Splice Site 525 558 9 10
Genomic Location (Zv9):
Chromosome 6 (position 13597624)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 13454903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACTGCCGGAGCAATAGCTACAGTCARGTTTGAAGAAGTCAAAGTCAAG[G/A]TGAGTCRGGGAAATAAAGTGTATTCCAAACAMAMACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link