dlb

Ensembl ID:
ENSDARG00000004232
ZFIN ID:
ZDB-GENE-980526-114
Description:
Delta-like protein B [Source:UniProtKB/Swiss-Prot;Acc:O57409]
Human Orthologue:
DLL3
Human Description:
delta-like 3 (Drosophila) [Source:HGNC Symbol;Acc:2909]
Mouse Orthologue:
Dll3
Mouse Description:
delta-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1096877]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20477 Nonsense Available for shipment Available now
sa16415 Nonsense Available for shipment Available now
sa16279 Nonsense Available for shipment Available now
sa16283 Nonsense Available for shipment Available now
sa38489 Nonsense Mutation detected in F1 DNA During 2017
sa1730 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019259 Nonsense 150 615 4 7

The following transcripts of ENSDARG00000004232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38295398)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36095082
KASP Assay ID:
2259-6172.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCGCTTGGCAGTTGGGGAAGACTGGTCTCAGGATGTTCACTTTGGCGAT[C/T]AGAGCGAGCTCCGTTACTCGTATCATGTGTTCTGTGATGAGTTTTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16415
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019259 Nonsense 186 615 4 7
ENSDART00000019259 Nonsense 186 615 4 7
ENSDART00000019259 Nonsense 186 615 4 7

The following transcripts of ENSDARG00000004232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38295508)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36095192
KASP Assay ID:
2259-6173.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCRGATTACTGCCGTCCTCGTGAYGACACGCTTGGCCACTATACCTG[C/A]GATGAGAATRGGAACAAGGAATGTYTGGTGGGATGGCAGGGAGACTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019259 Nonsense 186 615 4 7
ENSDART00000019259 Nonsense 186 615 4 7
ENSDART00000019259 Nonsense 186 615 4 7

The following transcripts of ENSDARG00000004232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38295508)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36095192
KASP Assay ID:
2259-6173.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCRGATTACTGCCGTCCTCGTGAYGACACGCTTGGCCACTATACCTG[C/A]GATGAGAATRGGAACAAGGAATGTYTGGTGGGATGGCAGGGAGACTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019259 Nonsense 186 615 4 7
ENSDART00000019259 Nonsense 186 615 4 7
ENSDART00000019259 Nonsense 186 615 4 7

The following transcripts of ENSDARG00000004232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38295508)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36095192
KASP Assay ID:
2259-6173.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTCRGATTACTGCCGTCCTCGTGAYGACACGCTTGGCCACTATACCTG[C/A]GATGAGAATRGGAACAAGGAATGTYTGGTGGGATGGCAGGGAGACTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019259 Nonsense 215 615 5 7

The following transcripts of ENSDARG00000004232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38296068)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36095752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTGTGTCTCCTCCCTCAGCCATCTGCTCTTCAGACTGCAGTGAA[C/T]GACATGGTTATTGCGAGTCTCCCGGAGAGTGCAAGTGTCGTCTGGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019259 Nonsense 467 615 7 7

The following transcripts of ENSDARG00000004232 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 38300509)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36100193
KASP Assay ID:
554-1675.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCACGCTGGGTTTCACTGGTAAAAACTGCAGCCTGCGAGCAGATGCTTG[T/A]CTTACGAACCCATGCCTCCACGGAGGAACATGTTTCACTCATTTCTCCGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link