dnah9

Ensembl ID:
ENSDARG00000004221
ZFIN ID:
ZDB-GENE-020925-1
Description:
dynein, axonemal, heavy polypeptide 9 [Source:RefSeq peptide;Acc:NP_956756]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1198 Essential Splice Site Available for shipment Available now
sa21988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023128 Essential Splice Site 120 614 2 10
Genomic Location (Zv9):
Chromosome 12 (position 229292)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 194228
KASP Assay ID:
554-1107.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGGAGATGCAAAATGAACCCACAATCCTCTTGTCCTGTGTCTGGCA[G/A]GTTGTGGAGCCGKTGTTGTCAAATTTGAACAACCAGCGAGACTTCCCTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023128 Nonsense 207 614 3 10
Genomic Location (Zv9):
Chromosome 12 (position 229628)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 193892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAAGCCTGATTCACTCAATGGAGACGGTGGTGATTGACTGGAGTCAT[C/T]AGGTCTATAAGGTCTTGAAGAAGGACTCGTCTGAGCCGCTGCTGGAGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link