efhc2

Ensembl ID:
ENSDARG00000004204
ZFIN ID:
ZDB-GENE-031001-10
Description:
EF-hand domain-containing family member C2 [Source:UniProtKB/Swiss-Prot;Acc:Q32TF8]
Human Orthologue:
EFHC2
Human Description:
EF-hand domain (C-terminal) containing 2 [Source:HGNC Symbol;Acc:26233]
Mouse Orthologue:
Efhc2
Mouse Description:
EF-hand domain (C-terminal) containing 2 Gene [Source:MGI Symbol;Acc:MGI:1921655]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41465 Nonsense Mutation detected in F1 DNA During 2016
sa31733 Nonsense Available for shipment Available now
sa21529 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008737 Nonsense 22 748 2 15
ENSDART00000142788 Nonsense 22 345 2 15
Genomic Location (Zv9):
Chromosome 9 (position 34739038)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33972066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAATAATGAAAACAAATCTCTTTCCAGCTTGGAAAAGACAAATTTCAC[A/T]AGTCTCAGCATTTTGATTATTCAAATGGAGTAGCTATGATGGTTGGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31733
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008737 Nonsense 80 748 3 15
ENSDART00000142788 Nonsense 80 345 3 15
ENSDART00000008737 Nonsense 80 748 3 15
ENSDART00000142788 Nonsense 80 345 3 15
Genomic Location (Zv9):
Chromosome 9 (position 34738768)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33971796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAATATACAAATTTACCCCCCTTTATTTACCTACCTGAAGGTCCTGTG[T/A]TTTGATGCTTATTTCAATGAAGATGTTCCTCAAAGGAGGGAAGAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21529
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008737 Nonsense 80 748 3 15
ENSDART00000142788 Nonsense 80 345 3 15
ENSDART00000008737 Nonsense 80 748 3 15
ENSDART00000142788 Nonsense 80 345 3 15
Genomic Location (Zv9):
Chromosome 9 (position 34738768)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33971796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAATATACAAATTTACCCCCCTTTATTTACCTACCTGAAGGTCCTGTG[T/A]TTTGATGCTTATTTCAATGAAGATGTTCCTCAAAGGAGGGAAGAAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link