efhc2

Ensembl ID:
ENSDARG00000004204
ZFIN ID:
ZDB-GENE-031001-10
Description:
EF-hand domain-containing family member C2 [Source:UniProtKB/Swiss-Prot;Acc:Q32TF8]
Human Orthologue:
EFHC2
Human Description:
EF-hand domain (C-terminal) containing 2 [Source:HGNC Symbol;Acc:26233]
Mouse Orthologue:
Efhc2
Mouse Description:
EF-hand domain (C-terminal) containing 2 Gene [Source:MGI Symbol;Acc:MGI:1921655]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21529 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008737 Nonsense 80 748 3 15
ENSDART00000142788 Nonsense 80 345 3 15
Genomic Location:
Chromosome 9 (position 34738768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAATATACAAATTTACCCCCCTTTATTTACCTACCTGAAGGTCCTGTG[T/A]TTTGATGCTTATTTCAATGAAGATGTTCCTCAAAGGAGGGAAGAAAAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yfbqz02f