si:dkey-15g19.1

Ensembl ID:
ENSDARG00000004184
ZFIN IDs:
ZDB-GENE-091111-4, ZDB-GENE-091118-59
Human Orthologues:
AL929601.1, NF1, NF1P4, NF1P5
Human Descriptions:
neurofibromin 1 pseudogene 4 [Source:HGNC Symbol;Acc:7769]
neurofibromin 1 pseudogene 5 [Source:HGNC Symbol;Acc:7770]
neurofibromin 1 [Source:HGNC Symbol;Acc:7765]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9IYV8]
Mouse Orthologue:
Nf1
Mouse Description:
neurofibromatosis 1 Gene [Source:MGI Symbol;Acc:MGI:97306]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27657 Nonsense Mutation detected in F1 DNA During 2017
sa27658 Nonsense Mutation detected in F1 DNA During 2017
sa34960 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16515 Nonsense Available for shipment Available now
sa41713 Nonsense Mutation detected in F1 DNA During 2017
sa21786 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021631 Nonsense 377 2759 10 57
ENSDART00000131897 Nonsense 373 636 10 57
Genomic Location (Zv9):
Chromosome 10 (position 38618940)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37341955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTAAGCCGTTTTCCAGAGGCGCAGGAAGTCAGAGTGCAGACCTGGACT[T/G]AATGATCGACTGCTTCGTCTCCTGTTTCAGAATCAACCCACACAACAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021631 Nonsense 767 2759 20 57
ENSDART00000131897   None 636 20 57
Genomic Location (Zv9):
Chromosome 10 (position 38629667)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37352682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAATGGATCAATATGACAGGCTTCTTGTGTGCGTTGGGCGGTGTGTG[T/A]TTGCAGCAGAGGCATGTGTCAGCTCTGGCCACCTACAGTCCTCCTATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021631 Essential Splice Site 1081 2759 None 57
ENSDART00000131897 Essential Splice Site None 636 None 57
Genomic Location (Zv9):
Chromosome 10 (position 38637345)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37360360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAACCTGCTTAGTGCCAATGTGGACAGCGGCCTGATGCACTCTATCGG[T/C]GGGAGAACCAAAAACTTTTATTTTATTTTATTTTATTTTATTTTGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021631 Nonsense 1327 2759 31 57
ENSDART00000131897   None 636 31 57
Genomic Location (Zv9):
Chromosome 10 (position 38650037)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37373052
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGTTTTCCTCAGAACAGCATTGGAGCTGTAGGCARTGCCATGTTCTTG[C/T]GATTCGTRAATCCAGCTATAGTCTCWCCATACGAGGCTGGGATTCTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021631 Nonsense 2064 2759 42 57
ENSDART00000131897   None 636 42 57
Genomic Location (Zv9):
Chromosome 10 (position 38707069)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37430084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTGAAGTGTTTTGTTCTTACCCTGTGCAGAGGAGACCAAGCAGGTGT[T/A]GCGTCTCAGTCTGACCGAGTTCTCCCTGCCGAAGTTCTACCTGCTGTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021631 Nonsense 2727 2759 57 57
ENSDART00000131897   None 636 57 57
Genomic Location (Zv9):
Chromosome 10 (position 38727704)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 37450719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAACAGGAATGGATAAAGAGAAAGTGGATCTATCCCCCACCACGGGTT[T/A]GGCAGCCGGCGGACGCACACGCCACGGCTCGGCCAGCCAGGTCCAGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link