si:ch211-32g22.2

Ensembl ID:
ENSDARG00000004177
ZFIN ID:
ZDB-GENE-091118-95
Description:
LOC553309 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZM1]
Human Orthologue:
FAM169A
Human Description:
family with sequence similarity 169, member A [Source:HGNC Symbol;Acc:29138]
Mouse Orthologue:
Fam169a
Mouse Description:
family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39324 Nonsense Mutation detected in F1 DNA During 2017
sa11663 Nonsense Available for shipment Available now
sa37263 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023640 Nonsense 14 364 2 11
ENSDART00000122015 Nonsense 14 508 2 13
ENSDART00000124807 Nonsense 14 826 1 12
Genomic Location (Zv9):
Chromosome 21 (position 14086653)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15787608
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTATAGGGATGGAGTTCCCTGTAGATGTTCTGGTGTCTGGCCGACAT[G/T]AAGACCTTGAAAGTTCAGCCCAAAGCTACATGAACAAACTTCTTTACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11663
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023640 Nonsense 109 364 5 11
ENSDART00000122015 Nonsense 109 508 5 13
ENSDART00000124807 Nonsense 109 826 4 12
Genomic Location (Zv9):
Chromosome 21 (position 14093064)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15794019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTTTCTAAAACACAAGTTTTTCTTYATGATTATATTTCGGCAGGTA[C/T]GATCTGTKGGCGAGAGGATAGTCTTATATGTACTGAACCGCATTATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023640 Essential Splice Site 165 364 5 11
ENSDART00000122015 Essential Splice Site 165 508 5 13
ENSDART00000124807 Essential Splice Site 165 826 4 12
Genomic Location (Zv9):
Chromosome 21 (position 14093234)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 15794189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGAAGAATGGAGAGGCAGTGGGCTTCTACTCGGTCAAATGTAAAGG[T/G]CAGTCCTTCTCCCAGCAGAGTCTGGTATTGCTCATTCTGCCTTCTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link