si:ch211-101b18.1

Ensembl ID:
ENSDARG00000004176
ZFIN ID:
ZDB-GENE-100922-243
Human Orthologue:
ULK4
Human Description:
unc-51-like kinase 4 (C. elegans) [Source:HGNC Symbol;Acc:15784]
Mouse Orthologue:
Ulk4
Mouse Description:
unc-51-like kinase 4 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1921622]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36032 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36033 Essential Splice Site, Missense Available for shipment Available now
sa17493 Nonsense Available for shipment Available now
sa22745 Nonsense Available for shipment Available now
sa6405 Essential Splice Site, Missense Mutation detected in F1 DNA During 2017
sa36034 Nonsense Mutation detected in F1 DNA During 2017
sa792 Essential Splice Site, Splice Site, Nonsense Available for shipment Available now
sa16618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36032
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Essential Splice Site 128 1048 4 32
ENSDART00000143540 Essential Splice Site 127 753 4 22
Genomic Location (Zv9):
Chromosome 16 (position 7162671)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6007202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTTTTTATTGTCAGAACTTAGCAATGTGTCACTTTGTGTTTCTGCA[G/T]ATTTTATTGGATGGACCGGGAACTCTTAAGTACTCCAATTTCTGCCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Missense 150 1048 4 32
ENSDART00000143540 Essential Splice Site 148 753 4 22
Genomic Location (Zv9):
Chromosome 16 (position 7162739)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6007270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAACTCTTAAGTACTCCAATTTCTGCCTGGCCAAAGCTCAAGGAGAAA[G/A]TTTGGAAGAGTTTTTTTCTCTTGTCATGGCTGAGGAGACAGGACTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Nonsense 242 1048 6 32
ENSDART00000143540 Nonsense 207 753 6 22
Genomic Location (Zv9):
Chromosome 16 (position 7163769)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6008300
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTATGACTGGTCTAGTTGATCTCATTTTAAAWGAAGATCCTCCACCYT[T/A]AAGACCTAAAGGTTTGASGCTTTTAATAAACTCAACCTTTTCAAAGCWGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Nonsense 665 1048 22 32
ENSDART00000143540 Nonsense 564 753 18 22
Genomic Location (Zv9):
Chromosome 16 (position 7236088)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6080619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCCGCTCAGGGATTCATCACTGCAGAGGTGGGACCTGCTCTCTGGTA[T/G]CTGTTCACACACTCCACGGTGGATGCTCTGAGGGTCAGCGCTATATCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Essential Splice Site 681 1048 None 32
ENSDART00000143540 Missense 581 753 18 22
Genomic Location (Zv9):
Chromosome 16 (position 7236138)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6080669
KASP Assay ID:
554-5242.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTTCACACACTCCACGGTGGATGCTCTGAGGGTCAGCGCTATATCTG[T/A]GAGTAWTAAACACACCACATTCACATCAYTCCAACACAAACGCAACACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Nonsense 849 1048 26 32
ENSDART00000143540 Nonsense 713 753 21 22
Genomic Location (Zv9):
Chromosome 16 (position 7277774)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6122305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTCCGTGTTAGGCAGTATTGTGGGACGGAAGCACCCCTCGCCCACA[C/T]AGTCCCGTCAGCTGAAGCAGAGCCTCCCCATGATGGCTGTGGTGCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa792
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Essential Splice Site 869 1048 26 32
ENSDART00000143540 Splice Site, Nonsense 734 753 21 22
Genomic Location (Zv9):
Chromosome 16 (position 7277837)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6122368
KASP Assay ID:
554-0697.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGCARAGCCTCCCCATGATGGCTGTGGTGCTGCATCTGCTCACCTCA[C/T]AGGTGTGTGTGTGTYTGTGTCAGGACTTACTATATTTACCTTTTTCACTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060519 Essential Splice Site 940 1048 29 32
ENSDART00000143540   None 753 None 22
Genomic Location (Zv9):
Chromosome 16 (position 7294295)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 6138826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGCCATTTCCCAGCATCCYGCTCTGCTCAGCCTCTACCCYTTCATTG[T/A]AAGCACAAGCACTGATGCACTTTTCATTTTGTGTCTTTYTCACAGTTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link