cnot1

Ensembl ID:
ENSDARG00000004174
ZFIN ID:
ZDB-GENE-040915-1
Description:
CCR4-NOT transcription complex subunit 1 [Source:UniProtKB/Swiss-Prot;Acc:A1A5H6]
Human Orthologue:
CNOT1
Human Description:
CCR4-NOT transcription complex, subunit 1 [Source:HGNC Symbol;Acc:7877]
Mouse Orthologues:
Cnot1, CT025624.1
Mouse Descriptions:
CCR4-NOT transcription complex subunit 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6ZQ08]
CCR4-NOT transcription complex, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:2442402]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14563 Nonsense Available for shipment Available now
sa15191 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017536 Nonsense 399 2375 11 49
ENSDART00000125459 Nonsense 399 2374 11 49
ENSDART00000141311 None None 293 None 7

The following transcripts of ENSDARG00000004174 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 17689614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGTCTGGGAATGGAAGTGTTCCCGGTGGATCTCATTTACAGACCATG[G/A]AAGCATGCAGAAGGACAGGTAAATAATGCACCACTCAGTTTTAAAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017536 Essential Splice Site 1269 2375 29 49
ENSDART00000125459 Essential Splice Site 1269 2374 29 49
ENSDART00000141311 Essential Splice Site 36 293 3 7

The following transcripts of ENSDARG00000004174 do not overlap with this mutation:

Genomic Location:
Chromosome 25 (position 17696838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CARGTTTTTGAWGAAYGGTTTTCACTCAGTCCCACWATTCTGTYGTTGCA[G/T]CTTAACCTCAAATTTGAGATTGAGGTACTCTGCAAGAATCTGTCTATGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: A common variant in SLC8A1 is associated with the duration of the electrocardiographic QT interval. (View Study)
  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nkisxefs