copa

Ensembl ID:
ENSDARG00000004173
ZFIN ID:
ZDB-GENE-020905-2
Description:
coatomer subunit alpha [Source:RefSeq peptide;Acc:NP_001001941]
Human Orthologue:
COPA
Human Description:
coatomer protein complex, subunit alpha [Source:HGNC Symbol;Acc:2230]
Mouse Orthologue:
Copa
Mouse Description:
coatomer protein complex subunit alpha Gene [Source:MGI Symbol;Acc:MGI:1334462]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2082 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048277 Essential Splice Site 407 1224 12 29
ENSDART00000122127 Essential Splice Site 408 1225 12 29
ENSDART00000130098 None None 539 None 14

The following transcripts of ENSDARG00000004173 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 36911405)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGATCTGTACTCCATTCCCAGAGAGAGTGACTCCCAGAATCCTGATGG[T/A]AACATTTGGACCTTTCTCTTTAGAACTYATTGTTTTATGTGCAAAAYGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8xrl5dnr