ik

Ensembl ID:
ENSDARG00000004161
ZFIN ID:
ZDB-GENE-030131-960
Description:
protein Red [Source:RefSeq peptide;Acc:NP_955883]
Human Orthologue:
IK
Human Description:
IK cytokine, down-regulator of HLA II [Source:HGNC Symbol;Acc:5958]
Mouse Orthologue:
Ik
Mouse Description:
IK cytokine Gene [Source:MGI Symbol;Acc:MGI:1345142]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43724 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43725 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012396 Essential Splice Site 6 548 2 20
Genomic Location (Zv9):
Chromosome 21 (position 42566434)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 44022264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTACAGTAATGTCCTAATAACGTGTCTGTCTGTTTTTTCCGTCTTTCA[G/A]CTGATGTGTACTCTAATCCTCTGGCTCCAGATGGCCATGAGGTGGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012396 Nonsense 313 548 11 20
Genomic Location (Zv9):
Chromosome 21 (position 42576391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTGTGTTTTCTGTTTTCAGGCCGTCTGGATGAGAAGAAAGCCCCA[G/T]AGGCCGACCTAAGGTGAGTTTACATGCGTAGTTAAACTTATTCGTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link