reep3

Ensembl ID:
ENSDARG00000004160
ZFIN ID:
ZDB-GENE-040426-730
Description:
Receptor expression-enhancing protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVX5]
Human Orthologue:
REEP3
Human Description:
receptor accessory protein 3 [Source:HGNC Symbol;Acc:23711]
Mouse Orthologue:
Reep3
Mouse Description:
receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22035 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021628 Essential Splice Site 139 256 5 8
ENSDART00000127187 Essential Splice Site 138 255 6 9
Genomic Location (Zv9):
Chromosome 12 (position 9620370)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 8828325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGGGCCTGACCATCGCTGCAACTGCTGCTGTGTCTGCTGCTGTCAAG[G/A]CAAGTGTGTGTGTGAGTTGAAGATGGACAAACGGAATAAGTTAAAGCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link