NP_001153308.1

Ensembl ID:
ENSDARG00000004158
Description:
transmembrane protein 63C [Source:RefSeq peptide;Acc:NP_001153308]
Human Orthologue:
TMEM63C
Human Description:
transmembrane protein 63C [Source:HGNC Symbol;Acc:23787]
Mouse Orthologue:
Tmem63c
Mouse Description:
transmembrane protein 63c Gene [Source:MGI Symbol;Acc:MGI:2444386]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36506 Nonsense Mutation detected in F1 DNA During 2017
sa36507 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36508 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23169 Splice Site, Nonsense Available for shipment Available now
sa15405 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074802 Nonsense 122 825 4 22
Genomic Location (Zv9):
Chromosome 17 (position 45017478)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44737351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTTTTATGACACCGTTGTCTTCCCTCCCTCTCTTTATAGGGCTTCTG[T/A]TCCTGGCTCACATCTTTGTACCACATGAAGTAAGTGTGCAGAAGTGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36507
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074802 Essential Splice Site 180 825 5 22
Genomic Location (Zv9):
Chromosome 17 (position 45024114)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44743987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCCCTCACCATCATCTTGCCCGTGAATCTCTCTGGAAACCTCCTCGG[T/C]ACCTTCACTACACACATCCTGCACTGGTTACTGTTTTCTCCAGCATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36508
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074802 Essential Splice Site 604 825 18 22
Genomic Location (Zv9):
Chromosome 17 (position 45061215)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44781088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAGAGCCAATAAATACTTTAGCCACCTCTTTCTCCTTTCTCCCCTC[A/T]GAGTCAGGCCTATGAGTTTCAGTTTGGTCTGGAATACGCCTGGACCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074802 Splice Site, Nonsense 733 825 20 22
Genomic Location (Zv9):
Chromosome 17 (position 45078187)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44798060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTGGATTCTGTATGAAAAAACTACGAGCTGACAGATCAACAAGCTAT[C/T]AGGTCAGCCACAGAAGCCTTTATCTTGAAACTTAAAAACTGTAATACTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074802 Essential Splice Site 733 825 20 22
Genomic Location (Zv9):
Chromosome 17 (position 45078190)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44798063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGATTCTGTMTGAAAAAACTACGRGCTGAMAGATCAACAAGCTATCAG[G/A]TCAGCCACAGAAGCCTTTATCTTSAAACTTAAAAACTGTAATACTAGRGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link