rab23

Ensembl ID:
ENSDARG00000004151
ZFIN ID:
ZDB-GENE-050522-328
Description:
ras-related protein Rab-23 [Source:RefSeq peptide;Acc:NP_001018579]
Human Orthologue:
RAB23
Human Description:
RAB23, member RAS oncogene family [Source:HGNC Symbol;Acc:14263]
Mouse Orthologue:
Rab23
Mouse Description:
RAB23, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:99833]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13880 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019983 Nonsense 164 237 6 7
Genomic Location:
Chromosome 13 (position 1264678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTAATGTTAAWMAGCATTTCTGTTTTTTTAATCTTGCAGTTTTTAAGTA[T/A]CTAGCTGACAAATATCTGCAGCGACTCAAGCAGCAGTCAGCRGAGGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/joi1du59