usp19

Ensembl ID:
ENSDARG00000004132
ZFIN ID:
ZDB-GENE-030131-3055
Description:
Ubiquitin carboxyl-terminal hydrolase [Source:UniProtKB/TrEMBL;Acc:B7ZDA8]
Human Orthologue:
USP19
Human Description:
ubiquitin specific peptidase 19 [Source:HGNC Symbol;Acc:12617]
Mouse Orthologue:
Usp19
Mouse Description:
ubiquitin specific peptidase 19 Gene [Source:MGI Symbol;Acc:MGI:1918722]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24302 Nonsense Mutation detected in F1 DNA During 2014
sa13973 Essential Splice Site Available for shipment Available now
sa17379 Nonsense Available for shipment Available now
sa12637 Nonsense Available for shipment Available now
sa3231 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa24302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112840 Nonsense 15 1436 1 25
ENSDART00000132025 None None 227 None 5
ENSDART00000147778 Nonsense 15 1478 2 26
Genomic Location:
Chromosome 23 (position 20464182)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGAAAATGGCCAGCAGCAGCACAGGATCCAGCGAATCAGGCCGCAGG[C/T]GAGGTCAGAGGGGACCGGATGACACGGTCAGCACCAGCAAGAAGAAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112840 Essential Splice Site 414 1436 5 25
ENSDART00000132025 None None 227 None 5
ENSDART00000147778 Essential Splice Site 414 1478 6 26
Genomic Location:
Chromosome 23 (position 20456416)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCCAAAGAGGAGCCACAAGGAGCAWGCCAAGAGGAGGATACGGAAGG[T/A]CAGTTAAAGGCATAGTTCATCCCAAAAYGACCAGCTCCCACCCRAATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17379
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112840 Nonsense 647 1436 10 25
ENSDART00000132025 None None 227 None 5
ENSDART00000147778 Nonsense 647 1478 11 26
Genomic Location:
Chromosome 23 (position 20450985)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTATGTCACCCTGGCTTCACTGGACTGGTCAATCTGGGAAACACTTG[C/A]TTTATGAACAGTGTGATCCAGTCCCTCTCCAACACACGGGAGCTCAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12637
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112840 Nonsense 1178 1436 21 25
ENSDART00000132025 None None 227 None 5
ENSDART00000147778 Nonsense 1171 1478 22 26
Genomic Location:
Chromosome 23 (position 20443066)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGCACACTAGAGCTGGTGTGGAAGAACAACGAGCGGCAGAAGGAATA[T/A]GTGCTGGTGCGCTCTAAAGATCTGGAGTTYGATGAGGACCCRGGCTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3231
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112840 Nonsense 1409 1436 25 25
ENSDART00000132025 Nonsense 200 227 5 5
ENSDART00000147778 None None 1478 None 26
Genomic Location:
Chromosome 23 (position 20434744)
KASP Assay ID:
554-3198.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCCAGACACTGTTTGGGACAGACCTGGATCCTGACGGGCCCCCTCAGT[T/A]GAGCACGGAAGTGACCTCAGACATGTTTGCACACTCTGGAGAATGTGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ayrvcnte