rttn

Ensembl ID:
ENSDARG00000004131
ZFIN ID:
ZDB-GENE-090609-5
Human Orthologue:
RTTN
Human Description:
rotatin [Source:HGNC Symbol;Acc:18654]
Mouse Orthologue:
Rttn
Mouse Description:
rotatin Gene [Source:MGI Symbol;Acc:MGI:2179288]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8719 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25211 Essential Splice Site Mutation detected in F1 DNA During 2014
sa801 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Essential Splice Site 227 2234 6 49
ENSDART00000142473 None None 318 None 9
Genomic Location:
Chromosome 24 (position 15156230)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGACTTCCCAGCTGAAATATTCCTGCAAAGGCCAAGTACAGTTCAAG[T/G]AAGACTTNNNNTTCATTTCTGTCTTCAATCTGTCTGTTGTTTTAACCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25211
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Essential Splice Site 435 2234 11 49
ENSDART00000142473 None None 318 None 9
Genomic Location:
Chromosome 24 (position 15135811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACATGCTCTTACTAACATCAGTCTTTTTGTACATGTGTTTTTTTTAA[G/A]AGAGAGAAATTACAGGCATGTATAGAGATTTTGGGAGATGTTATTTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006930 Nonsense 1037 2234 24 49
ENSDART00000142473 None None 318 None 9

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 24 (position 15109137)
KASP Assay ID:
554-0706.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGATCACCTGGAACACAGCATGGCATTCTGGGATTGATGGATTGCTA[G/T]AGCACCTGAGGGGTTTTAGAAGTGATGTGCCAGAGTAAGTTGGATTCATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g4hpnhez