mvk

Ensembl ID:
ENSDARG00000004130
ZFIN ID:
ZDB-GENE-041114-37
Description:
mevalonate kinase [Source:RefSeq peptide;Acc:NP_001007350]
Human Orthologue:
MVK
Human Description:
mevalonate kinase [Source:HGNC Symbol;Acc:7530]
Mouse Orthologue:
Mvk
Mouse Description:
mevalonate kinase Gene [Source:MGI Symbol;Acc:MGI:107624]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31423 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006673 Essential Splice Site 209 396 5 10
Genomic Location (Zv9):
Chromosome 5 (position 21281104)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18993976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCATTCATGGTAACCCTTCAGGGGTGGACAATGCTGTGGGCACATGGG[G/A]TAAGACTCTTAGGGTGCTTTCACACCTACACTTTTGTTTCGGAACGTATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link