mgat4b

Ensembl ID:
ENSDARG00000004115
ZFIN IDs:
ZDB-GENE-040704-19, ZDB-GENE-040704-19
Description:
Alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B [Source:UniProtKB/Swiss-Pro
Human Orthologue:
MGAT4B
Human Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B [Source:HGNC
Mouse Orthologue:
Mgat4b
Mouse Description:
mannoside acetylglucosaminyltransferase 4, isoenzyme B Gene [Source:MGI Symbol;Acc:MGI:2143974]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35655 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14606 Essential Splice Site Available for shipment Available now
sa22441 Nonsense Mutation detected in F1 DNA During 2016
sa28278 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001159 Essential Splice Site 33 547 None 15
ENSDART00000115340 Essential Splice Site 33 121 None 5
Genomic Location (Zv9):
Chromosome 14 (position 14436421)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16448371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGGCTTATATCGTTATCCTGGTACACCGCATTCAGCAATTCCAAAGG[T/C]AAGACCCACGGCTGGAAGCGCGTGTTTACGCTAAAGCAAACGCATCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001159 Essential Splice Site 93 547 3 15
ENSDART00000115340   None 121 None 5
Genomic Location (Zv9):
Chromosome 14 (position 14293948)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16305898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGACCATGGCATGCATTTATGTGTATCCATGTCGTCTCTCTCTCTCNN[A/G]GAKGAGACCAAGCTGAAGTTGTGGAACGTGACCAGCAGTAAGAATGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001159 Nonsense 190 547 5 15
ENSDART00000115340   None 121 None 5
Genomic Location (Zv9):
Chromosome 14 (position 14270098)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16282048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTAAACTATTGATTCTTGCTTTGTTTTTTTGCAGACGGATCAACAATA[T/A]GCAAATAGCGTTGCTGACAACCTTAAGCGCCTGTAAGTAGCCTGTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001159 Nonsense 448 547 12 15
ENSDART00000115340   None 121 None 5
Genomic Location (Zv9):
Chromosome 14 (position 14188744)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16200694
KASP Assay ID:
2260-7362.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTTCTAAGATTGATAGTTTTCCTGTTGTGTGTGTGTGTTTGCAGGTA[T/A]TTCTTCCGCAGTGGAAACATCGAGCACCCCGGAGACAAGCTTTTCAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link