mgat4b

Ensembl ID:
ENSDARG00000004115
ZFIN IDs:
ZDB-GENE-040704-19, ZDB-GENE-040704-19
Description:
Alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B [Source:UniProtKB/Swiss-Pro
Human Orthologue:
MGAT4B
Human Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B [Source:HGNC
Mouse Orthologue:
Mgat4b
Mouse Description:
mannoside acetylglucosaminyltransferase 4, isoenzyme B Gene [Source:MGI Symbol;Acc:MGI:2143974]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14606 Essential Splice Site Available for shipment Available now
sa22441 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001159 Essential Splice Site 93 547 3 15
ENSDART00000115340 None None 121 None 5
Genomic Location:
Chromosome 14 (position 14293948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGACCATGGCATGCATTTATGTGTATCCATGTCGTCTCTCTCTCTCNN[A/G]GAKGAGACCAAGCTGAAGTTGTGGAACGTGACCAGCAGTAAGAATGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000001159 Nonsense 190 547 5 15
ENSDART00000115340 None None 121 None 5
Genomic Location:
Chromosome 14 (position 14270098)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTAAACTATTGATTCTTGCTTTGTTTTTTTGCAGACGGATCAACAATA[T/A]GCAAATAGCGTTGCTGACAACCTTAAGCGCCTGTAAGTAGCCTGTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p4thg509