ENSDARG00000004109

Ensembl ID:
ENSDARG00000004109
Human Orthologues:
CD276, HHLA2, VTCN1
Human Descriptions:
CD276 molecule [Source:HGNC Symbol;Acc:19137]
HERV-H LTR-associating 2 [Source:HGNC Symbol;Acc:4905]
V-set domain containing T cell activation inhibitor 1 [Source:HGNC Symbol;Acc:28873]
Mouse Orthologues:
Cd276, Vtcn1
Mouse Descriptions:
CD276 antigen Gene [Source:MGI Symbol;Acc:MGI:2183926]
V-set domain containing T cell activation inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:3039619]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5727 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa5727
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067781 Essential Splice Site 314 483 8 8
Genomic Location:
Chromosome 3 (position 10165455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATGTTTATAATTTGYTGATCTGTAAAGCAGAATTTTCYATATTTCCA[G/A]CAGTGAACGTGACTCTTGATGCTGATTCTGCTCATCGTRATCTCATTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ax6wxlb6