tie1

Ensembl ID:
ENSDARG00000004105
ZFIN ID:
ZDB-GENE-990415-55
Description:
Tyrosine-protein kinase receptor Tie-1 [Source:UniProtKB/Swiss-Prot;Acc:O73792]
Human Orthologue:
TIE1
Human Description:
tyrosine kinase with immunoglobulin-like and EGF-like domains 1 [Source:HGNC Symbol;Acc:11809]
Mouse Orthologue:
Tie1
Mouse Description:
tyrosine kinase with immunoglobulin-like and EGF-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:9990

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25341 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9781 Nonsense Available for shipment Available now
sa9143 Nonsense Mutation detected in F1 DNA During 2014
sa14772 Essential Splice Site Available for shipment Available now
sa20737 Essential Splice Site Available for shipment Available now
sa2332 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Essential Splice Site 246 1122 6 23
Genomic Location:
Chromosome 6 (position 33698999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATGTCTGTAGAGACTATATGCATGTAAGAGTATTTTTCTGATTTTGC[A/T]GCCTGTCGGGAAGGAATGTTTGGTCGGAACTGCCAGGAATCCTGTAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Nonsense 371 1122 8 23
Genomic Location:
Chromosome 6 (position 33696580)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCACAAGATCACATGTTCTGCARCAGGCCATCCACTGCCTAGCCATT[T/A]GAGYATCGAGCTACGCAAGCTGGAAAGCACCGTTCTGAAGGTGAAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Nonsense 508 1122 11 23
Genomic Location:
Chromosome 6 (position 33693284)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCACATTACAAAACCTGAAGCCCTCAACCAAATACCATGTACGTGTA[C/T]AACTTGCTCGTCCAGGAGAAGGAGGAGAGGGTCCTTTGGGTCCAGAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Essential Splice Site 723 1122 13 23
Genomic Location:
Chromosome 6 (position 33692323)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGKACCTGGAGAGTGGAGCAGCTTCGTACAAGCTCAGACACCTGGAGAAG[G/A]TAGGAGACTAGGAGAAAATACTGAAATAACAACATAAATTTGTTTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Essential Splice Site 1066 1122 21 23
Genomic Location:
Chromosome 6 (position 33685173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCCAGGGATACAGAATGGAGCAGCCCAGAAACTGTGATGATGAAGTG[T/A]AAGCAGAAGATTGATCAACTGAAGCTGTAGTAATATTGCATTTATTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2332
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Nonsense 1067 1122 22 23
Genomic Location:
Chromosome 6 (position 33685092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATATTGCATTTATTATCACTGATATATTTAYAATTATCCATGCAGGTA[T/A]GAACTTATGAGGCAGTGCTGGCGAGATAGACCTTATGAGCGACCGCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zmk6mckl