tie1

Ensembl ID:
ENSDARG00000004105
ZFIN ID:
ZDB-GENE-990415-55
Description:
Tyrosine-protein kinase receptor Tie-1 [Source:UniProtKB/Swiss-Prot;Acc:O73792]
Human Orthologue:
TIE1
Human Description:
tyrosine kinase with immunoglobulin-like and EGF-like domains 1 [Source:HGNC Symbol;Acc:11809]
Mouse Orthologue:
Tie1
Mouse Description:
tyrosine kinase with immunoglobulin-like and EGF-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:9990

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25341 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40727 Nonsense Mutation detected in F1 DNA During 2016
sa9781 Nonsense Available for shipment Available now
sa9143 Nonsense Mutation detected in F1 DNA During 2016
sa14772 Essential Splice Site Available for shipment Available now
sa33892 Nonsense Mutation detected in F1 DNA During 2016
sa20737 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Essential Splice Site 246 1122 6 23
Genomic Location (Zv9):
Chromosome 6 (position 33698999)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34016664
KASP Assay ID:
554-7511.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATGTCTGTAGAGACTATATGCATGTAAGAGTATTTTTCTGATTTTGC[A/T]GCCTGTCGGGAAGGAATGTTTGGTCGGAACTGCCAGGAATCCTGTAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40727
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Nonsense 352 1122 8 23
Genomic Location (Zv9):
Chromosome 6 (position 33696637)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34014302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCGCGCACCAGAGATTTTAGACATAGCCAGTAACCTGGAGGGAAACT[T/A]GAACTCAAGCCACAAGATCACATGTTCTGCAACAGGCCATCCACTGCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Nonsense 371 1122 8 23
Genomic Location (Zv9):
Chromosome 6 (position 33696580)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34014245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCCACAAGATCACATGTTCTGCARCAGGCCATCCACTGCCTAGCCATT[T/A]GAGYATCGAGCTACGCAAGCTGGAAAGCACCGTTCTGAAGGTGAAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Nonsense 508 1122 11 23
Genomic Location (Zv9):
Chromosome 6 (position 33693284)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34010949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATCACATTACAAAACCTGAAGCCCTCAACCAAATACCATGTACGTGTA[C/T]AACTTGCTCGTCCAGGAGAAGGAGGAGAGGGTCCTTTGGGTCCAGAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Essential Splice Site 723 1122 13 23
Genomic Location (Zv9):
Chromosome 6 (position 33692323)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34009988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGKACCTGGAGAGTGGAGCAGCTTCGTACAAGCTCAGACACCTGGAGAAG[G/A]TAGGAGACTAGGAGAAAATACTGAAATAACAACATAAATTTGTTTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Nonsense 843 1122 15 23
Genomic Location (Zv9):
Chromosome 6 (position 33690324)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34007989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATGTCATCGGAGAAGGGAACTTCGGTCAGGTCATCAAGGCCATGGTC[A/T]AAAAAGATGGGATAAAAATGAGTGCTGCAATTAAAATGCTCAAGGGTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003701 Essential Splice Site 1066 1122 21 23
Genomic Location (Zv9):
Chromosome 6 (position 33685173)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 34002838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCCAGGGATACAGAATGGAGCAGCCCAGAAACTGTGATGATGAAGTG[T/A]AAGCAGAAGATTGATCAACTGAAGCTGTAGTAATATTGCATTTATTATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link