cx39.9

Ensembl ID:
ENSDARG00000004082
ZFIN ID:
ZDB-GENE-040406-2
Description:
connexin 39.9 [Source:RefSeq peptide;Acc:NP_997991]
Human Orthologue:
GJA3
Human Description:
gap junction protein, alpha 3, 46kDa [Source:HGNC Symbol;Acc:4277]
Mouse Orthologue:
Gja3
Mouse Description:
gap junction protein, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:95714]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11137 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11137
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013745 Nonsense 244 353 2 2
ENSDART00000125161 Nonsense 244 397 2 3
Genomic Location:
Chromosome 5 (position 25304348)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGGGTCTCCGTTACCGGCGTGCTCACTCAGTCTGCGACACTGAGTCT[A/T]AAGTGCCTAGTGAGGACGTTGTKGTTCCTTTTGTGCMRAATTACCCTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xmj75nlx