bach2

Ensembl ID:
ENSDARG00000004074
ZFIN ID:
ZDB-GENE-041001-139
Description:
Novel protein similar to human and mouse BTB and CNC homology 1, basic leucine zipper transcription
Human Orthologue:
BACH2
Human Description:
BTB and CNC homology 1, basic leucine zipper transcription factor 2 [Source:HGNC Symbol;Acc:14078]
Mouse Orthologue:
Bach2
Mouse Description:
BTB and CNC homology 2 Gene [Source:MGI Symbol;Acc:MGI:894679]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23698 Nonsense Available for shipment Available now
sa37023 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23698
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Nonsense 500 823 3 5
ENSDART00000131857 Nonsense 473 796 2 4
Genomic Location (Zv9):
Chromosome 20 (position 23979164)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24097965
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCCAAAGGCCCAATACCAGCTGCCCAGTGCCAATTAAGGTATGCCCA[C/T]GATCGCCCCCTTCAGAGACCCGCACTCGGACCTCCAGTTCCTGTTCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028717 Nonsense 816 823 5 5
ENSDART00000131857 Nonsense 789 796 4 4
Genomic Location (Zv9):
Chromosome 20 (position 23956751)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 24075552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGTAGACTTCTGTCAAGAGATGACAGATAAATGTACAACTGACGAA[C/T]AGCCCAACAGAAAGGACTGTACCTAATGACGGTGGTTTCTCTGTGTTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link