bhlhe40

Ensembl ID:
ENSDARG00000004060
ZFIN ID:
ZDB-GENE-030131-3133
Description:
class E basic helix-loop-helix protein 40 [Source:RefSeq peptide;Acc:NP_997844]
Human Orthologue:
BHLHE40
Human Description:
basic helix-loop-helix family, member e40 [Source:HGNC Symbol;Acc:1046]
Mouse Orthologue:
Bhlhe40
Mouse Description:
basic helix-loop-helix family, member e40 Gene [Source:MGI Symbol;Acc:MGI:1097714]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16419 Nonsense Available for shipment Available now
sa21951 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16419
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026017 Nonsense 56 403 3 5
ENSDART00000128382 Nonsense 56 403 3 6
Genomic Location:
Chromosome 11 (position 36603369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATAGTTTTATCTGCTGACCCCYAGGAWACGTACAAACTGCCTCATCGAT[T/A]GATCGAGAAGAAAAGAAGAGACCGAATAAACGAGTGCATCGCGCAGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026017 Essential Splice Site 124 403 4 5
ENSDART00000128382 Essential Splice Site 124 403 4 6
Genomic Location:
Chromosome 11 (position 36602792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACAGCAACAACAGAAGATCATTTCCTTGCAGAATGGATTGCAAATCG[G/A]TGAGTTTTTGATAATACCAAAAGGTCGGCACATCAAATGTGTGACCATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mely23ve