uhrf1bp1l

Ensembl ID:
ENSDARG00000004055
ZFIN ID:
ZDB-GENE-041210-177
Description:
UHRF1-binding protein 1-like [Source:RefSeq peptide;Acc:NP_001093475]
Human Orthologue:
UHRF1BP1L
Human Description:
UHRF1 binding protein 1-like [Source:HGNC Symbol;Acc:29102]
Mouse Orthologue:
Uhrf1bp1l
Mouse Description:
UHRF1 (ICBP90) binding protein 1-like Gene [Source:MGI Symbol;Acc:MGI:2442888]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16858 Essential Splice Site Available for shipment Available now
sa10068 Essential Splice Site Available for shipment Available now
sa14650 Essential Splice Site Available for shipment Available now
sa3492 Nonsense Mutation detected in F1 DNA During 2014
sa20255 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Essential Splice Site 55 1402 None 20
ENSDART00000135330 Essential Splice Site 69 1416 None 21
Genomic Location:
Chromosome 4 (position 17330025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCTGGCTCGCCATTAATAAAGTCTTCTGCAATAAAGCYGCCATCCGGG[T/C]AAGAGACACGTCTGCTCGTTCAAGACAKCATCACTTTGAGTCCCTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Essential Splice Site 266 1402 6 20
ENSDART00000135330 Essential Splice Site 280 1416 7 21
Genomic Location:
Chromosome 4 (position 17317566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAAATCMGCTTCGCARAGGAAGAGCATGGCCCCYGACACTACACAGG[T/C]GCGAGTTTGAGGACTCTTCCCTKCCTCCTACCCCARTCACCACCACCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Essential Splice Site 355 1402 8 20
ENSDART00000135330 Essential Splice Site 369 1416 9 21
Genomic Location:
Chromosome 4 (position 17317021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTTTTAGTTCTATCAGYGTAGACTATTACCCTTTCCACAAAGCTGG[T/C]AATAYATTARATACATTATTTGTACTATACTTTTGAAGAGGAAARTRTTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Nonsense 486 1402 11 20
ENSDART00000135330 Nonsense 500 1416 12 21
Genomic Location:
Chromosome 4 (position 17311048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATTCACGCCGAATTCACAGAGTACTACTTCCCAGATGGCAAGGACTA[T/A]CCAGGTAAAACAGAAGGGATCCCATCCATCAGAATGTTCAGCTTTTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046871 Nonsense 1365 1402 20 20
ENSDART00000135330 Nonsense 1379 1416 21 21
Genomic Location:
Chromosome 4 (position 17277623)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGATCTTTTTCCATCCACACAGCTGCTCGTGGAGGAGAATGAATGCT[T/A]GAAGCTGGAGCTCTCCAAAGCCAAGATGGCGTTAGCAGAAGCGCAGATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/33y6imrv