phf6

Ensembl ID:
ENSDARG00000004046
ZFIN ID:
ZDB-GENE-030131-5278
Description:
PHD finger protein 6 [Source:RefSeq peptide;Acc:NP_956059]
Human Orthologue:
PHF6
Human Description:
PHD finger protein 6 [Source:HGNC Symbol;Acc:18145]
Mouse Orthologue:
Phf6
Mouse Description:
PHD finger protein 6 Gene [Source:MGI Symbol;Acc:MGI:1918248]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13009 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006463 Nonsense 48 363 3 11
ENSDART00000138341 Nonsense 48 267 3 9
Genomic Location (Zv9):
Chromosome 14 (position 32367401)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31157208
KASP Assay ID:
2260-7689.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAATGCCTNNTGTGTNNGTNNGGTTTGTTTTTGTTTTCAACTCAGCTATTCTCAT[C/A]AGCCTTGGTCACATCTCATTCAGACAGTGAAAACATYGGAGGCTTTTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link