cog2

Ensembl ID:
ENSDARG00000004037
ZFIN ID:
ZDB-GENE-040426-2671
Description:
conserved oligomeric Golgi complex subunit 2 [Source:RefSeq peptide;Acc:NP_998519]
Human Orthologue:
COG2
Human Description:
component of oligomeric golgi complex 2 [Source:HGNC Symbol;Acc:6546]
Mouse Orthologue:
Cog2
Mouse Description:
component of oligomeric golgi complex 2 Gene [Source:MGI Symbol;Acc:MGI:1923582]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8649 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18123 Essential Splice Site Available for shipment Available now
sa12307 Essential Splice Site Available for shipment Available now
sa12578 Essential Splice Site Available for shipment Available now
sa8564 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8649
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
Genomic Location:
Chromosome 13 (position 24240587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTATTAATAAAGACTATGCAGATTTCGTTAAYCTCTCCACCAATCTTG[T/C]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
Genomic Location:
Chromosome 13 (position 24240587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTATTAATAAAGACTATGCAGATTTCGTYAAYCTCTCCACCAATCTTG[T/C]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
ENSDART00000026189 Essential Splice Site 74 730 2 18
Genomic Location:
Chromosome 13 (position 24240587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTATTAATAAAGACTATGCAGATTTCGTYAAYCTCTCCACCAATCTTG[T/A]AAGTSTTTGGTCTTTATTAACATTACTTTATCAGCAGAATTGTGTGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12578
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 295 730 8 18
Genomic Location:
Chromosome 13 (position 24234453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCACTGCAGACTTCTGCGAGAGGTGACCGGTGGCGCAATCTCTAGG[T/C]ATGTTTGCCACTCACATAAAACTTTTACAGCATTGAGCCATTGTWGTCAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026189 Essential Splice Site 455 730 12 18
Genomic Location:
Chromosome 13 (position 24226996)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACTCAYTCTGCAGCTCATCTCCAGATACTCCACCTTTCTTACCGAGG[T/C]AATGCATTYCAGCTGAGAGGAATTTGAATCATAATAATAGAGTTATTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ifaig248