chrm5a

Ensembl ID:
ENSDARG00000004026
ZFIN ID:
ZDB-GENE-080723-32
Description:
muscarinic acetylcholine receptor M5 [Source:RefSeq peptide;Acc:NP_001018639]
Human Orthologue:
CHRM5
Human Description:
cholinergic receptor, muscarinic 5 [Source:HGNC Symbol;Acc:1954]
Mouse Orthologue:
Chrm5
Mouse Description:
cholinergic receptor, muscarinic 5 Gene [Source:MGI Symbol;Acc:MGI:109248]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7816 Nonsense Mutation detected in F1 DNA During 2014
sa12034 Nonsense Available for shipment Available now
sa4004 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7816
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012932 Nonsense 177 490 1 1
Genomic Location:
Chromosome 17 (position 394974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATTTTGTGCTGGCAGTATTTTGTTGGTAAAAGAACCGTWCCTGAAAGA[C/T]AGTGCCAGATTCAGTTTTTCTCCGAGCCTGTGATCACCTTCGGGACGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012932 Nonsense 226 490 1 1
Genomic Location:
Chromosome 17 (position 394827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGGATATACAAGGAGACCGAAAGACGCACTAAAGATCTTGCCGAACTT[C/T]AAGGCATCAACTCGTCAACAAATTCCAGCGGAGACGCTCAGCCTCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012932 Nonsense 326 490 1 1
Genomic Location:
Chromosome 17 (position 394525)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTCTTYCCAACTCCAGTCAAAGCAAGTCCTACGAAGACCAAGAAGTG[T/A]GTTTCGTATAAATTCAAACCGAAAGATRTCAGTCCGCTAAAGAACACTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jpm5hjdc