si:ch211-236h17.3

Ensembl ID:
ENSDARG00000004018
ZFIN IDs:
ZDB-GENE-030131-738, ZDB-GENE-090312-162
Human Orthologue:
CHST13
Human Description:
carbohydrate (chondroitin 4) sulfotransferase 13 [Source:HGNC Symbol;Acc:21755]
Mouse Orthologue:
Chst13
Mouse Description:
carbohydrate (chondroitin 4) sulfotransferase 13 Gene [Source:MGI Symbol;Acc:MGI:1919047]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17439 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17439
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013449 Nonsense 169 340 3 3
Genomic Location (Zv9):
Chromosome 23 (position 35026824)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 34925685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTCGGAGTACTCAACAGCCGAGATCAACAAGCGTCTACGCACATATMTG[A/T]AGTTTGTTTTCGTGCGTGAACCCTTYGAGAGATTAGTCTCTGCCTATCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link