fhl2b

Ensembl ID:
ENSDARG00000003991
ZFIN ID:
ZDB-GENE-041010-121
Description:
four and a half LIM domains 2b [Source:RefSeq peptide;Acc:NP_001006028]
Human Orthologue:
FHL2
Human Description:
four and a half LIM domains 2 [Source:HGNC Symbol;Acc:3703]
Mouse Orthologue:
Fhl2
Mouse Description:
four and a half LIM domains 2 Gene [Source:MGI Symbol;Acc:MGI:1338762]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20673 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20672 Nonsense Available for shipment Available now
sa141 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Essential Splice Site None 279 1 7
ENSDART00000124132 Essential Splice Site None 279 1 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 15001238)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCATAGCACATCACATCACACCACTCCTCTCCTCTCCACGGGACAGG[C/A]AAGTTAAGCATCGCAACAATTATAACCTCTTCTCTTCTCTTCTCTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Nonsense 70 279 3 7
ENSDART00000124132 Nonsense 70 279 3 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 14984259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGTCTTATAAAGACCGGCACTGGCACGACGACTGCTTCCACTGCTTC[A/T]AATGTCACCGTTCTCTTGTGGACAAGCCATTTTCTACCAAGGACGAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003898 Nonsense 97 279 3 7
ENSDART00000124132 Nonsense 97 279 3 6

The following transcripts of ENSDARG00000003991 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 14984176)
KASP Assay ID:
554-1340.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTACCAAGGACGAGCAGCTACTGTGTACCGAGTGCTACTCCAATGAGTA[T/G]TCCTCTAAATGTTTCGAATGCAAGAAGACAATCATGCCAGGTGAGTGAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xoia3s4m