crhr1

Ensembl ID:
ENSDARG00000003989
ZFIN ID:
ZDB-GENE-081231-1
Human Orthologue:
CRHR1
Human Description:
corticotropin releasing hormone receptor 1 [Source:HGNC Symbol;Acc:2357]
Mouse Orthologue:
Crhr1
Mouse Description:
corticotropin releasing hormone receptor 1 Gene [Source:MGI Symbol;Acc:MGI:88498]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2110 Essential Splice Site F2 line generated During 2016
sa19989 Essential Splice Site Available for shipment Available now
sa26049 Nonsense Mutation detected in F1 DNA During 2016
sa11535 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2110
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Essential Splice Site 57 431 2 13
Genomic Location (Zv9):
Chromosome 3 (position 21970933)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21627324
KASP Assay ID:
554-3008.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTAATCCTGTGGAACCAGACATCTAGTCCAACCACTAACTCTACAGG[T/G]CAGTTTAAAACTTGTCTTTATAATCTGTAATCATGACAGATTTAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Essential Splice Site 161 431 6 13
Genomic Location (Zv9):
Chromosome 3 (position 22064425)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21720816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGTTCCCTCCTTTGCATCTTTGGCCTCCTCCATCTTTCCTTCTCCCA[G/T]GAGTATCCGGTGTCTGAGAAATATCATCCACTGGAACCTGATTACAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Nonsense 228 431 7 13
Genomic Location (Zv9):
Chromosome 3 (position 22072943)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21729334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTATTTCCATGTGACCAATTTCTTCTGGATGTTTGGAGAAGGCTGTTA[T/A]CTGCACACTGCCATAGTATTGACATACTCTACAGACAAACTGAGGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111751 Nonsense 288 431 9 13
Genomic Location (Zv9):
Chromosome 3 (position 22077624)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 21734015
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGTGCTGGTTTGGGAAGCGAGCCGGCATTTACRCWGATTATATTTA[T/A]CAGGGTCCCATGATCCTGGTYCTACTGGTGAGTCAACAGAATTTAGATTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link