si:dkey-175g6.5

Ensembl ID:
ENSDARG00000003984
ZFIN ID:
ZDB-GENE-091204-127
Human Orthologue:
LTN1
Human Description:
listerin E3 ubiquitin protein ligase 1 [Source:HGNC Symbol;Acc:13082]
Mouse Orthologue:
Ltn1
Mouse Description:
listerin E3 ubiquitin protein ligase 1 Gene [Source:MGI Symbol;Acc:MGI:1926163]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21729 Essential Splice Site Available for shipment Available now
sa21730 Nonsense Available for shipment Available now
sa41656 Nonsense Mutation detected in F1 DNA During 2017
sa13774 Nonsense Available for shipment Available now
sa1642 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa21729
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022170 Essential Splice Site 116 1751 3 30
ENSDART00000135890 Essential Splice Site 116 1749 3 30
Genomic Location (Zv9):
Chromosome 10 (position 23361876)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23133169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGGTGTCCTGCCATACTGGCCTCGGATATACTGCCGGATATCGATGG[T/C]AAATATTTAATCATTATAGTTATACATTCGTAAATATGTAATACATCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022170 Nonsense 1023 1751 17 30
ENSDART00000135890 Nonsense 1023 1749 17 30
Genomic Location (Zv9):
Chromosome 10 (position 23376037)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23147330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACCAATACTTTTTTATTGTGTAGTTTCAGAGATTTTTTATGGCCTG[C/T]AGTGGTGTGAAGAAATGGAGTTTTCACCCCTCACAGTGTCTGAATATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022170 Nonsense 1076 1751 18 30
ENSDART00000135890 Nonsense 1076 1749 18 30
Genomic Location (Zv9):
Chromosome 10 (position 23376321)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23147614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTTGTATCTTTTTTTTAATTACAGATCACAAGAAAATGGATCTCTCT[G/A]GTCACTGTGTCTGGCGAAATACTTGCAAATCAATAAAATGGACCCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022170 Nonsense 1133 1751 19 30
ENSDART00000135890 Nonsense 1133 1749 19 30
Genomic Location (Zv9):
Chromosome 10 (position 23377850)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23149143
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGCTCTGTCCGTTTCTAGCCAGCGAAGACAGAGAATCCCTCATYGCCT[T/A]GTGTGTYGCAGAGCTACTCAACTGGCAGGACCAAGAGCACGACTGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1642
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022170 Essential Splice Site 1731 1751 29 30
ENSDART00000135890 Essential Splice Site 1729 1749 29 30
Genomic Location (Zv9):
Chromosome 10 (position 23397038)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23168331
KASP Assay ID:
554-1582.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGAAAGCTTGCCGTACCTGCAAAAAGAAGTTYCACTCCGCCTGTCTA[G/A]TGAGTGCCACACACACACACACACACACACACACACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link