isl2a

Ensembl ID:
ENSDARG00000003971
ZFIN ID:
ZDB-GENE-980526-562
Description:
Insulin gene enhancer protein isl-2a [Source:UniProtKB/Swiss-Prot;Acc:P53406]
Human Orthologue:
ISL2
Human Description:
ISL LIM homeobox 2 [Source:HGNC Symbol;Acc:18524]
Mouse Orthologue:
Isl2
Mouse Description:
insulin related protein 2 (islet 2) Gene [Source:MGI Symbol;Acc:MGI:109156]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24714 Nonsense Available for shipment Available now
sa24713 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012862 Nonsense 48 359 2 6
Genomic Location (Zv9):
Chromosome 25 (position 33734090)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32344402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAGATCCATGATCAGTACATACTGCGGGTGTCCCCGGACCTGGAGTG[G/A]CACGCAGCCTGTCTGAAGTGCGCAGAATGCAGTCAGTACCTGGATGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012862 Nonsense 209 359 4 6
Genomic Location (Zv9):
Chromosome 25 (position 33731635)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32341947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTTCGGACAGTATTAAACGAAAAGCAGCTTCACACCCTCCGGACGTG[T/A]TATAATGCAAACCCTCGACCGGACGCGCTAATGAAAGAGCAGCTCGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link