LOC566281

Ensembl ID:
ENSDARG00000003970
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20140 Nonsense Mutation detected in F1 DNA During 2014
sa2105 Nonsense F2 line generated During 2014
sa8148 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20140
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055945 Nonsense 37 471 2 7
Genomic Location:
Chromosome 3 (position 53252668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCCCCATCTGCGGAAGTATTCTGCAAAAGCCTGTAGTGCTGTTTTGC[A/T]GACATCGCTTCTGTAAACCTTGCCTGGAAAGCCTGTGGAACGGTGGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2105
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055945 Nonsense 76 471 2 7
Genomic Location:
Chromosome 3 (position 53252551)
KASP Assay ID:
554-2896.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCTGTCAGCCGTCATCTATGGGGGAGCTCGTAGTCAACACCGTGCTT[G/T]AGAAGACCTGCGAGGGCTTTCTGGAGAAATGCAAAAATGACCCTCTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055945 Nonsense 151 471 3 7
Genomic Location:
Chromosome 3 (position 53248152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTTTCTAGGAGGAACTCAAAAATGCTTTAAAACCACTTCWGGAAAAGT[T/A]GAAGCTCTTCCGAAAAGTAAAACTCACCTGTGAGCATGCAGTGAATCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3ys5q7om