LOC566281

Ensembl ID:
ENSDARG00000003970
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20140 Nonsense Available for shipment Available now
sa2105 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa20140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055945 Nonsense 37 471 2 7
Genomic Location (Zv9):
Chromosome 3 (position 53252668)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52359983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCCCCATCTGCGGAAGTATTCTGCAAAAGCCTGTAGTGCTGTTTTGC[A/T]GACATCGCTTCTGTAAACCTTGCCTGGAAAGCCTGTGGAACGGTGGAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2105
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055945 Nonsense 76 471 2 7
Genomic Location (Zv9):
Chromosome 3 (position 53252551)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 52359866
KASP Assay ID:
554-2896.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCTGTCAGCCGTCATCTATGGGGGAGCTCGTAGTCAACACCGTGCTT[G/T]AGAAGACCTGCGAGGGCTTTCTGGAGAAATGCAAAAATGACCCTCTTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link