tlx1

Ensembl ID:
ENSDARG00000003965
ZFIN ID:
ZDB-GENE-021021-2
Description:
T-cell leukemia homeobox protein 1 [Source:RefSeq peptide;Acc:NP_739571]
Human Orthologues:
TLX1, TLX2, TLX3
Human Descriptions:
T-cell leukemia homeobox 1 [Source:HGNC Symbol;Acc:5056]
T-cell leukemia homeobox 2 [Source:HGNC Symbol;Acc:5057]
T-cell leukemia homeobox 3 [Source:HGNC Symbol;Acc:13532]
Mouse Orthologues:
Tlx1, Tlx2, Tlx3
Mouse Descriptions:
T-cell leukemia, homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:98769]
T-cell leukemia, homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:1350935]
T-cell leukemia, homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:1351209]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11549 Nonsense Available for shipment Available now
sa22315 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006393 Nonsense 200 301 2 3
Genomic Location:
Chromosome 13 (position 28494207)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCGCCTTCAGATATGTGAGCTGGAGAAACGCTTTCACCGTCAGAAGTA[T/A]CTGGCGTCAGCCGAGAGAGCAGCCTTAGCGAAAGCACTTAAAATGACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006393 Essential Splice Site 232 301 2 3
Genomic Location:
Chromosome 13 (position 28494111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGATGCGCAGGTCAAAACATGGTTCCAGAACAGAAGAACGAAATGGAG[G/A]TGAGCTTTTGCGATCTAATCAAGGCTTTACACTCACACGTAATGCATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0qcrwbbv