parp3

Ensembl ID:
ENSDARG00000003961
ZFIN ID:
ZDB-GENE-030131-7435
Description:
poly [Source:RefSeq peptide;Acc:NP_956795]
Human Orthologue:
PARP3
Human Description:
poly (ADP-ribose) polymerase family, member 3 [Source:HGNC Symbol;Acc:273]
Mouse Orthologue:
Parp3
Mouse Description:
poly (ADP-ribose) polymerase family, member 3 Gene [Source:MGI Symbol;Acc:MGI:1891258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8845 Nonsense Mutation detected in F1 DNA During 2017
sa26806 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022949 Nonsense 309 531 7 11
Genomic Location (Zv9):
Chromosome 6 (position 41973545)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42045145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTTGCCCAGAGTCTTAAAGCTGAATCTGAGAAAGCCAARGAAGAGATG[G/T]ARGACACTGTGCCTCATCCAGTTGACCAAAATTACCAGTCTCTGAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022949 Essential Splice Site 425 531 9 11
Genomic Location (Zv9):
Chromosome 6 (position 41972446)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 42044046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGGGAATCTATTTTGCCTCTGAAAACAGTAAATCTGCTGGCTATGG[T/G]GAGGAACACAGTATAAGCATTGAAAAGAAAACAATTGATACAACATGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link